Sequence ID | >WENV170001290 |
Genome ID | AGBK01010741 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 167 |
End posion on genome | 241 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttgtcgaagt |
tRNA gene sequence |
GCGGGATTAGTACAATGGTTAGTACGTGACCTTCCCAAGGTCAAGGTGCCGGTTCGATTC |
Downstream region at tRNA end position |
cccattgaaa |
Secondary structure (Cloverleaf model) | >WENV170001290 Gly CCC t TCCT cccattgaaa G - C C - G G - C G - C G - C A - T T - A T T T T G G C C A T A A A + | | | | G G C A T G G C C G G C G | | | | T T T G T A C T A G AGGT T - A G - C A - T C - G C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |