Sequence ID | >WENV170001291 |
Genome ID | AGBK01011142 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 4 |
End posion on genome | 78 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
nnnnnnngtc |
tRNA gene sequence |
GCCCTCGTAGCTTAACGGATAAAGCCTGGGCTTGCGGAGCCCGTAATGGAGGTTCGAATC |
Downstream region at tRNA end position |
agaaaaatta |
Secondary structure (Cloverleaf model) | >WENV170001291 Arg GCG c ACGA agaaaaatta G - C C - G C - G C - G T - A C - G G - C T A T C C T C C A C A A A | | | | | G G T T C G G G A G G C G | | | | T T A A A G C T A C TAAT T + G G - C G - C G - C C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |