Sequence ID | >WENV170001295 |
Genome ID | AGBK01011787 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 3 |
End posion on genome | 93 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
nnnnnnnnat |
tRNA gene sequence |
GGAGCGGTGGCCGAGTGGTTAAAGGCTCCAGACTGTAAATCTGGCCCCCGATGTGGTACT |
Downstream region at tRNA end position |
aatatagcac |
Secondary structure (Cloverleaf model) | >WENV170001295 Tyr GTA t ACCA aatatagcac G - C G - C A - T G - C C - G G - C G - C T A T C A T C C A T G A G | | | | | G G G C C G G T A G G C G | | | T T T A G G C T A A T CCCCCGATGTGGTACTATC C - G C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |