Sequence ID | >WENV170001297 |
Genome ID | AGBK01012500 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 126 |
End posion on genome | 49 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggcaattttg |
tRNA gene sequence |
CGGAGAGTAGCGCAGCCTGGCTAGCGCGCAGCGTTCGGGACGCTGAAGTCGCCGGTTCAA |
Downstream region at tRNA end position |
gaactagctg |
Secondary structure (Cloverleaf model) | >WENV170001297 Pro CGG g ACCA gaactagctg C - G G - C G - C A - T G - C A - T G - C T A T C G G C C A C C G A A | | | | | A T C G C G G C C G G C G | | | | T T G G C G C C T A G AAGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |