Sequence ID | >WENV170004116 |
Genome ID | AGTN01565027 |
Search identical group | |
Phylum/Class | [AGTN] bioreactor metagenome; poplar biomass |
Species | |
Start position on genome | 197 |
End posion on genome | 273 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
agtgaggcag |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCACTAGACTACGAATCTAGGGGTCAGGAGTTCGAA |
Downstream region at tRNA end position |
tttcaccgga |
Secondary structure (Cloverleaf model) | >WENV170004116 Arg ACG g GCCA tttcaccgga G - C C - G G - C C - G C - G C - G G - C T A T T T C T C A C G A A | + | | | G T C T C G A G G A G C G | | | | T T G G A G C A T A A GGGTC C - G T - A A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |