Sequence ID | >WENV170004647 |
Genome ID | AHKK01000090 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1536 |
End posion on genome | 1612 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
attcttctaT |
tRNA gene sequence |
GTCTCGGTAGCACAATTGGTAGTTGCACATGGCTGTTAACCATGAGGTTGGCGGTTCGAG |
Downstream region at tRNA end position |
ggcttgtagc |
Secondary structure (Cloverleaf model) | >WENV170004647 Asn GTT T GTCg ggcttgtagc G - C T - A C - G T - A C - G G - C G - C T G T T C G C C A T A A A + | | | | G T C A C G G G C G G C G | | | T T G T T G C T A G A AGGTT C - G A - T T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |