Sequence ID | >WENV170004649 |
Genome ID | AHKK01000175 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 3763 |
End posion on genome | 3837 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtaagtgccT |
tRNA gene sequence |
GCCGCCGTAACTCAGTTGGTAGAGTGCCCGGCTGTTAACCGGATTGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
caattcctta |
Secondary structure (Cloverleaf model) | >WENV170004649 Asn GTT T GTaa caattcctta G - C C - G C - G G - C C - G C - G G - C C G T T G T C C A T G A A | | | | | G T C T C A A C A G G C G | | | | T T G G A G T T A G TTGTC C A C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |