Sequence ID | >WENV170004650 |
Genome ID | AHKK01000211 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1688 |
End posion on genome | 1616 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aatgcttata |
tRNA gene sequence |
GGGCCCGTGGTCTAGTTGGAATGACGTCGCCTTGACATGGCGGAGGTCGTGCGTTCAAAT |
Downstream region at tRNA end position |
aatctaccca |
Secondary structure (Cloverleaf model) | >WENV170004650 Val GAC a Atag aatctaccca G - C G - C G - C C - G C - G C - G G - C T A T T A C G C A T G A G + | | | | A T T C T G G T G C G C G | | | T T G T G A C A A G AGGTC T + G C - G G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |