Sequence ID | >WENV170004651 |
Genome ID | AHKK01000314 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 931 |
End posion on genome | 855 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttcccagcgt |
tRNA gene sequence |
GGGCCGTTAGCTCAGCCTGGCAGAGCAGGGGCCTTTTAAGCCCAGGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
gcaaaagtga |
Secondary structure (Cloverleaf model) | >WENV170004651 Lys TTT t ACCA gcaaaagtga G - C G - C G - C C - G C - G G - C T - A T A T T G T C C A C G A A | | | | | G C C T C G A C A G G C T | | | | T T G G A G C G C A A GGGCC G A G - C G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |