Sequence ID | >WENV170004654 |
Genome ID | AHKK01000700 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 8241 |
End posion on genome | 8167 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgtacaataa |
tRNA gene sequence |
AGCGGGGTAGGGTAGTTAGGAGATCCCGTCGGGCTCATAACCCGGAGATCGATGGTTCGA |
Downstream region at tRNA end position |
tattaacgga |
Secondary structure (Cloverleaf model) | >WENV170004654 Met CAT a Attc tattaacgga A - T G - C C - G G - C G - C G + T G - C T A T C T A C C A T T G A A | | | | | G A T G G G G A T G G C G | | | T T G T C C C A G A G AGATC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |