Sequence ID | >WENV170004655 |
Genome ID | AHKK01000893 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1133 |
End posion on genome | 1207 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ggaagaaaat |
tRNA gene sequence |
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCGGCAGTTCAAG |
Downstream region at tRNA end position |
cttaatcgct |
Secondary structure (Cloverleaf model) | >WENV170004655 Ile GAT t ACat cttaatcgct A - T G - C T - A C - G C - G C - G G - C T G T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |