Sequence ID | >WENV170004656 |
Genome ID | AHKK01000893 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1221 |
End posion on genome | 1297 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttaatcgctt |
tRNA gene sequence |
GGGGAATTAGCTCAGTTGGCTAGAGCACTAGCTTTGCAAGCTAGGGGTCATCGGTTCGAA |
Downstream region at tRNA end position |
gttagttaag |
Secondary structure (Cloverleaf model) | >WENV170004656 Ala TGC t ACTA gttagttaag G - C G - C G + T G - C A - T A - T T - A T A T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A A GGGTC C - G T - A A - T G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |