Sequence ID | >WENV170004660 |
Genome ID | AHKK01001817 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 889 |
End posion on genome | 976 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attattttgt |
tRNA gene sequence |
GCCGGAGTGGTGAAATTGGTAGACGCAGAGGACTCAAAATCCTCCGAACTTTAAGTTCGT |
Downstream region at tRNA end position |
aggaaaaaca |
Secondary structure (Cloverleaf model) | >WENV170004660 Leu CAA t ACCA aggaaaaaca G - C C - G C - G G - C G - C A - T G - C T T T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | + | T T G A C G C T A G A CGAACTTTAAGTTCGT G - C A - T G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |