Sequence ID | >WENV170004661 |
Genome ID | AHKK01002050 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 629 |
End posion on genome | 555 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tgcaacaagt |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTAGGACACCGGCCTCTCACGCCGGGAGCAGGGGTTCAATTC |
Downstream region at tRNA end position |
aacaatacct |
Secondary structure (Cloverleaf model) | >WENV170004661 Glu CTC t ACCA aacaatacct G - C G + T T - A C - G C - G C - G A - T T T T T C C C C A C G A C | | | | | A G T C T G A G G G G C G + | | | T T T G G A C T A A GAGC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |