Sequence ID | >WENV170004662 |
Genome ID | AHKK01002217 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 556 |
End posion on genome | 482 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
acgaataaaT |
tRNA gene sequence |
GCCCGGGTGGTGTAGCGGCCTATCATTGAGCCCTGTCGAGGCTCGGACTCGGGTTCAAAT |
Downstream region at tRNA end position |
atttactgtt |
Secondary structure (Cloverleaf model) | >WENV170004662 Asp GTC T GTtt atttactgtt G - C C - G C - G C - G G + T G - C G - C T A T A G C C C A C G A G | | | | | A G T G T G T C G G G C G | | + T T C T C A T C T A T GGAC G - C A - T G - C C - G C - G C A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |