Sequence ID | >WENV170004664 |
Genome ID | AHKK01002977 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 11 |
End posion on genome | 85 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aaaaacatac |
tRNA gene sequence |
AGGCACGTAGCTCAGGGGGAGAGCGCTACCCTGACACGGTAGAAGTCGGTGGTTCAAATC |
Downstream region at tRNA end position |
gaaaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170004664 Val GAC c ACCA gaaaaatcaa A - T G - C G - C C - G A - T C - G G - C T A T T C A C C A G A A + | | | | A G C T C G G G T G G C G | | | | T T G G A G C G A G AAGTC C - G T - A A - T C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |