Sequence ID | >WENV170004666 |
Genome ID | AHKK01004220 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 53 |
End posion on genome | 123 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agtgaaaaaa |
tRNA gene sequence |
GCGTCGATGGTCTAGAGGCATGACTTAGGCCTTCCAAGCCTAAAGCCCGGGTTCAAATCC |
Downstream region at tRNA end position |
ctcaaatggt |
Secondary structure (Cloverleaf model) | >WENV170004666 Gly TCC a Atcg ctcaaatggt G - C C - G G - C T - A C - G G - C A - T T A T G G C C C A G A G | | | | | A A T C T G C C G G G C G | | | T T G T G A C C A T AAGC T - A A - T G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |