Sequence ID | >WENV170004668 |
Genome ID | AHKK01004366 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 261 |
End posion on genome | 174 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cataactgat |
tRNA gene sequence |
GTCGGGATAGCCAAGAGGTCTACGGCGGTAGGTTGCTAACCTACTTCCCCTTCGGGGAGC |
Downstream region at tRNA end position |
tgtcaaatcc |
Secondary structure (Cloverleaf model) | >WENV170004668 Ser GCT t GCTA tgtcaaatcc G - C T + G C - G G - C G - C G - C A - T T A T C T C C C A A G A A | | | | | G G A C C G G A G G G C G | | | T T T C G G C C T A G TTCCCCTTCGGGGAGC G - C T - A A - T G - C G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |