Sequence ID | >WENV170004670 |
Genome ID | AHKK01005398 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 187 |
End posion on genome | 262 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caccacgtct |
tRNA gene sequence |
GGGGATGTAGCTCAGATGGGAGAGCGCCTCCCTTGCACGGAGGAGGTCAGGGGTTCGAGT |
Downstream region at tRNA end position |
gtcgcttgac |
Secondary structure (Cloverleaf model) | >WENV170004670 Ala TGC t ACCA gtcgcttgac G - C G - C G + T G - C A - T T - A G - C T G T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A C - G C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |