Sequence ID | >WENV170004671 |
Genome ID | AHKK01005444 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 403 |
End posion on genome | 491 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccccggaact |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGACGATGGCGACGGTCTTGAAAACCGTTGTGGCGACAAGTCAC |
Downstream region at tRNA end position |
gatgaacaac |
Secondary structure (Cloverleaf model) | >WENV170004671 Ser TGA t GCCT gatgaacaac G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | G G G C C G G T G G G C G + | | | T T A T G G C C G A G TGTGGCGACAAGTCACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |