Sequence ID | >WENV170004672 |
Genome ID | AHKK01005444 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 517 |
End posion on genome | 609 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agcgatactc |
tRNA gene sequence |
GGGGAGGTGCCAGAGTGGTTGATCGGGGCCGCCTGCTAAGCGGTTGTGGGGTTAATAGCT |
Downstream region at tRNA end position |
tttcgcgccc |
Secondary structure (Cloverleaf model) | >WENV170004672 Ser GCT c GCCT tttcgcgccc G - C G - C G - C G - C A - T G - C G - C T A T G T C C C A T G A G | | | | | G G G A C C C A G G G C G + | | T T T T C G G T G A G TGTGGGGTTAATAGCTCCACC G + T C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |