Sequence ID | >WENV170004674 |
Genome ID | AHKK01005586 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 218 |
End posion on genome | 305 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gagatagggT |
tRNA gene sequence |
GCCAGGGTGGCAGAGTGGACAAATGCGGTGGCCTCGAGAGTCACTGTCCCTTTTGGGACG |
Downstream region at tRNA end position |
ggttcgcttt |
Secondary structure (Cloverleaf model) | >WENV170004674 Ser CGA T GTaa ggttcgcttt G - C C - G C - G A - T G - C G - C G - C T A T A G T C C A T G A G | | | | | A G G A C G T C A G G C G | | | T T A A T G C C A A G TGTCCCTTTTGGGACGC G - C T - A G - C G + T C - G C A T G C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |