Sequence ID | >WENV170004677 |
Genome ID | AHKK01006383 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 115 |
End posion on genome | 201 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gcacacctcT |
tRNA gene sequence |
GCGGGGGTTGCCAAGCCAGGTCAACGGCGCAGGATTTAAGCTCCTGTTGTGAAGACATTC |
Downstream region at tRNA end position |
tcagcccctg |
Secondary structure (Cloverleaf model) | >WENV170004677 Leu TAA T ATtc tcagcccctg G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A T | | | | | G A A C C G A A G G G C G | | | T T G C G G C T C A A G TTGTGAAGACATTC C - G A - T G - C G - C A - T T C T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |