Sequence ID | >WENV170004679 |
Genome ID | AHKK01006476 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 189 |
End posion on genome | 103 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttaattttgt |
tRNA gene sequence |
GCCGAAGTGGCGGAACTGGTAGACGCGCTAGGTTCAGGGTCTAGTGGGTGTATGCCTGTG |
Downstream region at tRNA end position |
tactcaaaac |
Secondary structure (Cloverleaf model) | >WENV170004679 Leu CAG t ACCA tactcaaaac G - C C - G C - G G - C A - T A - T G - C T G T C C C T C A C A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G G TGGGTGTATGCCTGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |