Sequence ID | >WENV170004683 |
Genome ID | AHKK01006985 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 9553 |
End posion on genome | 9478 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tatgtagcaT |
tRNA gene sequence |
GGGGTCGTGGCCTAGTTTGGAAGGGCAGCGGGCTCCAGACTCGCCGATCGTGTGTTCGAA |
Downstream region at tRNA end position |
atgatagaat |
Secondary structure (Cloverleaf model) | >WENV170004683 Trp CCA T ATta atgatagaat G - C G - C G - C G - C T + G C - G G - C T A T C A C G C A T G A G | | | + | G T T C C G G T G T G C T + | | | T T G G G G C G A A A CGATC G - C C - G G - C G + T G - C C A T G C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |