Sequence ID | >WENV170004687 |
Genome ID | AHKK01007416 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 5220 |
End posion on genome | 5143 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaagagaaaa |
tRNA gene sequence |
GGGCCCGTGGCATAGCCAGGATAAAGCACCGGCCTTCTAAGCCGGGGATCGCGGGTTCGA |
Downstream region at tRNA end position |
gtttatattt |
Secondary structure (Cloverleaf model) | >WENV170004687 Arg TCT a GTCA gtttatattt G - C G - C G + T C - G C - G C - G G - C T A T C G C C C A C C G A G | | | | | G A T A C G G C G G G C G | | | T T G A A G C A T A A GGATC C - G C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |