Sequence ID | >WENV170004688 |
Genome ID | AHKK01007461 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1138 |
End posion on genome | 1212 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taatttgaat |
tRNA gene sequence |
GGGGCCGTAGCTCAGACTGGGAGAGCGCTCGGCTGAAGACCGAGTTGTCCCGAGTTCAAA |
Downstream region at tRNA end position |
acgcttgaga |
Secondary structure (Cloverleaf model) | >WENV170004688 Phe GAA t ACtg acgcttgaga G - C G - C G - C G - C C - G C - G G - C T A T G G C T C A A G A A | | | | | A C C T C G C C G A G C T | | | | T T G G A G C G G A G TTGTC C - G T - A C - G G - C G - C C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |