Sequence ID | >WENV170004695 |
Genome ID | AHKK01007646 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 292 |
End posion on genome | 363 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttccgagaga |
tRNA gene sequence |
GGGGTCGTAGGGTAGGGGATATCCTGTCAGGTTCCGGACCTGACGACCTGGGTTCGAATC |
Downstream region at tRNA end position |
tcgcggctac |
Secondary structure (Cloverleaf model) | >WENV170004695 Arg CCG a Gttc tcgcggctac G - C G - C G + T G - C T - A C - G G - C T A T G A C C C A G G A A | | | | | G G T G G G C T G G G C G | | + T T A T C C T T A G CGAC T - A C - G A - T G - C G - C T A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |