Sequence ID | >WENV170004698 |
Genome ID | AHKK01007680 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1087 |
End posion on genome | 1016 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
taaaaggcgg |
tRNA gene sequence |
GGGCTCGTAGCTCAGTGGAAGAGTGCCTCCTTCGCGAGGAGGAAGCCACGGGTTCAAATC |
Downstream region at tRNA end position |
gataagtaga |
Secondary structure (Cloverleaf model) | >WENV170004698 Ala CGC g Ataa gataagtaga G - C G - C G + T C - G T - A C - G G - C T A T T G C C C A G A A | | | | | A T C T C G A C G G G C G | | | + T T G G A G T A A G AAGCC C - G C - G T - A C - G C - G T A T G C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |