Sequence ID | >WENV170004701 |
Genome ID | AHKK01008118 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1331 |
End posion on genome | 1405 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tactacgcgc |
tRNA gene sequence |
GGGCTTGTAGATCAATGGAAGATCGCTGTCGTCGCAGGGCAGAGGCTCCGGGTTCGAGTC |
Downstream region at tRNA end position |
cgaatacctt |
Secondary structure (Cloverleaf model) | >WENV170004701 Ala CGC c ATCA cgaatacctt G - C G - C G + T C - G T - A T - A G - C T G T G G C C C A A A A | | | | | G T C T A G C C G G G C G | | | | T T G G A T C A A G AGGCT C - G T - A G - C T + G C - G G G T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |