Sequence ID | >WENV170004704 |
Genome ID | AHKK01008302 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1094 |
End posion on genome | 1008 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
nnnnnnnaat |
tRNA gene sequence |
GGGGAGGTACCAAAGTGGTTAAATGGAGCGGACTGTAGATCCGCTGGCTGAACGCCTTCG |
Downstream region at tRNA end position |
ttttaggtat |
Secondary structure (Cloverleaf model) | >WENV170004704 Tyr GTA t ACCA ttttaggtat G - C G - C G - C G - C A - T G - C G - C T A T C T T C C A T G A A | | | | | G G A A C C G A A G G C G | | | T T T A T G G T A A A TGGCTGAACGCCTTC G - C C - G G - C G - C A - T C A T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |