Sequence ID | >WENV170004705 |
Genome ID | AHKK01008302 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 994 |
End posion on genome | 919 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taggtattat |
tRNA gene sequence |
GCCCGCGTAGCTCAGTCGGAAGAGCGCATCCTTGGTAAGGATGAGGTCACCAGTTCAATT |
Downstream region at tRNA end position |
gttaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170004705 Thr GGT t TCCA gttaaatcaa G - C C - G C - G C - G G + T C - G G - C T T T T G G T C A T G A A | | | | | A C C T C G A C C A G C G | | | | T T G G A G C A A G AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |