Sequence ID | >WENV170004706 |
Genome ID | AHKK01008475 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1074 |
End posion on genome | 999 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cacacaatgt |
tRNA gene sequence |
GCGCCCGTAGCTCAGGGGATAGAGCGTCAGCCTCCGGAGCTGAAAGCCGCTGGTTCGAAT |
Downstream region at tRNA end position |
ttttgtctca |
Secondary structure (Cloverleaf model) | >WENV170004706 Arg CCG t ACCA ttttgtctca G + T C - G G - C C - G C - G C - G G - C T A T C G A C C A G G A A | | | | | G G C T C G G C T G G C G | | | | T T A G A G C T A G AAGCC T - A C - G A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |