Sequence ID | >WENV170004707 |
Genome ID | AHKK01008562 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 379 |
End posion on genome | 453 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cttctaaaat |
tRNA gene sequence |
AGGCACGTAGCTCAGGGGGAGAGCGCTACCCTGACACGGTAGAAGTCGACAGTTCAAATC |
Downstream region at tRNA end position |
aatgccgaaa |
Secondary structure (Cloverleaf model) | >WENV170004707 Val GAC t ACCA aatgccgaaa A - T G - C G - C C - G A - T C - G G - C T A T C T G T C A G A A | | | | | A G C T C G G A C A G C G | | | | T T G G A G C G A G AAGTC C - G T - A A - T C - G C - G C C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |