Sequence ID | >WENV170004708 |
Genome ID | AHKK01008687 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 808 |
End posion on genome | 735 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taaatatgaa |
tRNA gene sequence |
GGGCTCGTGGTCTAGTTGGTTATGACACCGCCTTCACACGGCGGAGGTCATGCGTTCGAA |
Downstream region at tRNA end position |
aattaaacca |
Secondary structure (Cloverleaf model) | >WENV170004708 Val CAC a Atta aattaaacca G - C G - C G - C C - G T + G C - G G - C T A T T A C G C A T G A G | | | | | G T T C T G A T G C G C G | | | T T G T G A C T T A A AGGTC C - G C - G G - C C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |