Sequence ID | >WENV170004712 |
Genome ID | AHKK01009058 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 279 |
End posion on genome | 209 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gaaataccgg |
tRNA gene sequence |
GCGGCAATAGTCTAGTGGTAGGACATAGGCTTCCCAAGCCTGTAACCCGGGTTCGAGCCC |
Downstream region at tRNA end position |
aaacttcctc |
Secondary structure (Cloverleaf model) | >WENV170004712 Gly CCC g Aata aaacttcctc G - C C - G G - C G - C C - G A - T A - T C G T G G C C C A G A A | | | | | G T T C T G C C G G G C G + | | | T T G G G A C T A A TAAC T + G A - T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |