Sequence ID | >WENV170004713 |
Genome ID | AHKK01009115 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 999 |
End posion on genome | 1071 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccagaacaac |
tRNA gene sequence |
GCCAGGGTGGCGGAGCGGCTAACGCGATCGCCTGCAGAGCGATTCTATTCCGGTTCGAAT |
Downstream region at tRNA end position |
cgcaatgttt |
Secondary structure (Cloverleaf model) | >WENV170004713 Cys GCA c Ttat cgcaatgttt G - C C - G C - G A - T G - C G - C G - C T A T A G G C C A C G A G | | | | | G G G G C G T C C G G C G | | | T T C A C G C T A G TCTAT A - T T - A C - G G - C C - G C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |