Sequence ID | >WENV170004714 |
Genome ID | AHKK01009149 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1750 |
End posion on genome | 1823 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agaaggggga |
tRNA gene sequence |
GGGGCAGTAGGGTAGCCAGGTTATCCTCGTGGCTTTGGGAGCCATGGACCCCAGTTCGAA |
Downstream region at tRNA end position |
aataaaatta |
Secondary structure (Cloverleaf model) | >WENV170004714 Pro TGG a Ataa aataaaatta G - C G - C G - C G - C C - G A - T G - C T A T G G G T C A C C G A A | | | | | G A T G G G C C C A G C G | | + T T G T C C T T T A C GGAC G + T T - A G - C G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |