Sequence ID | >WENV170004715 |
Genome ID | AHKK01009150 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1569 |
End posion on genome | 1651 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atctggcaaa |
tRNA gene sequence |
GCGGAGGTTACCGAGTGGCCAAAGGAGGCAGACTCAAGATCTGCTCCCGTAGGGGTTCGC |
Downstream region at tRNA end position |
agaagcaaaa |
Secondary structure (Cloverleaf model) | >WENV170004715 Leu CAA a Atgc agaagcaaaa G - C C - G G - C G - C A - T G - C G - C T A T C G T C C A T G A T | | | | | G G G C C A G C A G G C G | | T T C A G G A C A A G TCCCGTAGGGGTTC G - C C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |