Sequence ID | >WENV170004717 |
Genome ID | AHKK01009336 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 69 |
End posion on genome | 144 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gtgatggcac |
tRNA gene sequence |
GGGCTCGTAGATCAGTTGGAAGATCGTCGCCTTTGCAAGGCGAAGGCCCTGGGTTCGAGT |
Downstream region at tRNA end position |
tgagcacaaa |
Secondary structure (Cloverleaf model) | >WENV170004717 Ala TGC c ATCA tgagcacaaa G - C G - C G + T C - G T - A C - G G - C T G T G A C C C A T G A A | | | | | G T C T A G C T G G G C G | | | | T T G G A T C A A G AGGCC T - A C - G G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |