Sequence ID | >WENV170004721 |
Genome ID | AHKK01009746 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 103 |
End posion on genome | 29 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ctatatttgT |
tRNA gene sequence |
GGAGCCGTGTGGTAGCGGACTATCCCATCGGGCTTCGAACCCGATGACCTGGGTTCAAAT |
Downstream region at tRNA end position |
atgcttcttt |
Secondary structure (Cloverleaf model) | >WENV170004721 Arg TCG T GTat atgcttcttt G - C G - C A - T G - C C - G C - G G - C T A T G A C C C A C G A G | | | | | A G T G G T C T G G G C G | | T T A T C C C C T A A TGAC T - A C - G G - C G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |