Sequence ID | >WENV170004726 |
Genome ID | AHKK01010097 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 705 |
End posion on genome | 630 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctcttaacac |
tRNA gene sequence |
GCCAGCGTAGCTCAGCTGGTAGAGCTACTGATTTGTAATCAGTGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
ttaatctata |
Secondary structure (Cloverleaf model) | >WENV170004726 Thr TGT c TCCA ttaatctata G - C C - G C - G A - T G - C C - G G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A T GGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |