Sequence ID | >WENV170004727 |
Genome ID | AHKK01010097 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 568 |
End posion on genome | 484 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aatcaaatat |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGTCAAAGGGAACAGACTGTAAATCTGTCGGCAAAGCCTTCGGA |
Downstream region at tRNA end position |
ttttcaggcc |
Secondary structure (Cloverleaf model) | >WENV170004727 Tyr GTA t ACCA ttttcaggcc G - C G - C T - A G - C G + T G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T T A G G G C A A A CGGCAAAGCCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |