| Sequence ID | >WENV170004728 |
| Genome ID | AHKK01010097 |
| Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
| Species | |
| Start position on genome | 297 |
| End posion on genome | 222 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
agtggtgtta |
| tRNA gene sequence |
GCGGGAGTAGCTCAGCTGGTAGAGCTCTAGCCTTCCAAGCTGGAGGTCGCGAGTTCGAAT |
| Downstream region at tRNA end position |
gacaggccca |
| Secondary structure (Cloverleaf model) | >WENV170004728 Gly TCC
a TCCA gacaggccca
G - C
C - G
G - C
G - C
G - C
A - T
G - C T A
T T G C T C A
C G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T A T AGGTC
C - G
T + G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |