Sequence ID | >WENV170004728 |
Genome ID | AHKK01010097 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 297 |
End posion on genome | 222 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agtggtgtta |
tRNA gene sequence |
GCGGGAGTAGCTCAGCTGGTAGAGCTCTAGCCTTCCAAGCTGGAGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
gacaggccca |
Secondary structure (Cloverleaf model) | >WENV170004728 Gly TCC a TCCA gacaggccca G - C C - G G - C G - C G - C A - T G - C T A T T G C T C A C G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A T AGGTC C - G T + G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |