Sequence ID | >WENV170004732 |
Genome ID | AHKK01010367 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 1286 |
End posion on genome | 1360 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tatcctttgT |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGAAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAC |
Downstream region at tRNA end position |
ctttttttac |
Secondary structure (Cloverleaf model) | >WENV170004732 Met CAT T ATgc ctttttttac G - C G - C G - C C - G C - G C - G A - T C A T G G A C C A C G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C A A C AGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |