Sequence ID | >WENV170004735 |
Genome ID | AHKK01010578 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 416 |
End posion on genome | 491 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agatctcaca |
tRNA gene sequence |
GGGCCGTTAACTCAGCTGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
tgtatatgta |
Secondary structure (Cloverleaf model) | >WENV170004735 Lys TTT a ACCA tgtatatgta G - C G - C G - C C - G C - G G - C T - A C G T C G C G C A C G A A | | | | | G T C T C A G C G C G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |