Sequence ID | >WENV170004738 |
Genome ID | AHKK01010996 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 252 |
End posion on genome | 178 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgaccaattc |
tRNA gene sequence |
TGGGGCGTCGTCAAGCGGTAAGACACAGGACTTTGGTTCCTGCATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
ggttataaat |
Secondary structure (Cloverleaf model) | >WENV170004738 Gln TTG c GCCA ggttataaat T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A C | | | | | G C A C T G G G A G G C G | | | T T G A G A C T A A CATTC C - G A - T G - C G - C A - T C T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |