Sequence ID | >WENV170004741 |
Genome ID | AHKK01011076 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 194 |
End posion on genome | 120 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccgcacatca |
tRNA gene sequence |
GGCGACGTGGCCAAGTGGTAAGGCAGGGGTCTGCAAAACCCTTATTCGTCGGTTCAATTC |
Downstream region at tRNA end position |
caagatagca |
Secondary structure (Cloverleaf model) | >WENV170004741 Cys GCA a TCCT caagatagca G - C G - C C - G G - C A - T C - G G - C T T T C A G C C A G A G | | | | | A T A C C G G T C G G C G | | | T T G A G G C T A A TATTC G + T G - C G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |