Sequence ID | >WENV170004743 |
Genome ID | AHKK01011366 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 488 |
End posion on genome | 414 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taagaataat |
tRNA gene sequence |
GGGCGATTAACTCAGTGGGAGAGTGCTACCTTCACACGGTAGAAGTCACTGGTTCAAATC |
Downstream region at tRNA end position |
gctctgaaaa |
Secondary structure (Cloverleaf model) | >WENV170004743 Val CAC t ACCA gctctgaaaa G + T G - C G - C C - G G - C A - T T - A T A T T G A C C A G A A | | | | | A T C T C A A C T G G C G | | | | T T G G A G T G A G AAGTC C - G T - A A - T C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |