Sequence ID | >WENV170004746 |
Genome ID | AHKK01011807 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 326 |
End posion on genome | 252 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ataaatctga |
tRNA gene sequence |
GCGGGAATAACTCAGCGGTAGAGTGCGACCTTGCCAAGGTCGAAGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
tttcttggtc |
Secondary structure (Cloverleaf model) | >WENV170004746 Gly GCC a TCCA tttcttggtc G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A G A A + | | | | A C C T C A G C G G G C G | | | | T T G G A G T T A G AAGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |